Download App

Reproductive Health — BIOLOGY STD 12 Science — Question

Gujarat BoardEnglish MediumSTD 12 ScienceBIOLOGYReproductive Health1 Mark
MCQ
An $\text{IUCD}$ is:
  • ✓
    Copper$-T$
  • B
    Condom
  • C
    Vasectomy
  • D
    Pill
✓

Answer

Correct option: A.
Copper$-T$

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

More "M.C.Q (1 Marks)" from Reproductive Health→Reproductive Health — all question types→BIOLOGY STD 12 Science question papers→Gujarat Board STD 12 Science question papers→Gujarat Board question paper generator→

Similar questions

If the number of chromosomes in root cells is $14$, what will be the number of chromosomes in synergids cells of an ovule of that parent
→
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
→
Which process of decomposition is correctly described?
→
Identify the correctly matched pairs of the germ layers and their derivatives.

$I.$Ectoderm - Epidermis

$II$.Endoderm - Dermis

$III.$Mesoderm - Muscles

$IV.$Mesoderm - Notochord

$V.$Endoderm - Enamel of teeth

→
$A$ : Curd is more nutritious than milk.

$R$ : $LAB$ present in curd checks growth of disease causing microbes.

→
The first mammals were like ...$A$... Their fossils are small sized. Mammals were ...$B$... and protected their unborn young inside the mother's body

Choose the correct option for $A$ and $B$ to complete the given $NCERT$ statement

→
The successive nucleotides of $RNA$ are covalently linked through or antiparallal
→
Cultivation of Bt cotton has been much in the news. The prefix Btmeans
→
The following are the steps involved in the life cycle of the malarial parasite.
  1. Mosquito bites and injects sporozoites.
  2. Mosquitoes take up gametocyctes during blood sucking.
  3. Sporozoites reach liver through blood, divide and go to blood.
  4. Sporozoites migrate to the salivary gland of mosquito.
  5. Parasites reproduce in $\text{RBCs},$ burst and infect new cells.
Arrange the above events in the order of their occurrence.
→
Personal hygiene includes $...........$
→