Download App

Human Health and Disease — BIOLOGY STD 12 Science — Question

Gujarat BoardEnglish MediumSTD 12 ScienceBIOLOGYHuman Health and Disease1 Mark
MCQ
Ascaris performs:
  • A
    Aerobic respiration
  • ✓
    Anaerobic respiration
  • C
    Both $A$ and $B$
  • D
    None of the above
✓

Answer

Correct option: B.
Anaerobic respiration
Mode of respiration in Ascaris is obligatory anaerobic as it lives in an oxygen deficient environment in the intestine.
The obligatory anaerobic organism cannot survive by the normal atmospheric concentration of oxygen.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

More "M.C.Q (1 Marks)" from Human Health and Disease→Human Health and Disease — all question types→BIOLOGY STD 12 Science question papers→Gujarat Board STD 12 Science question papers→Gujarat Board question paper generator→

Similar questions

Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

→
About $15$ mya primates......... was more man-like while ............. was more ape like.
→
Which one among the following is known as universal diversity?
→
Which of the following is not a property of the genetic code?
→
Code of $m - RNA$ and proteins are
→
The first law of Mendel
→
The two antibiotic resistance genes on vector $pBR322$ are for
→
The functions of tapetum is to:
→
Malaria parasite completes its life-cycle in
→
Which among the following brings the amino acid to the protein synthesis site?
→