MCQ
Choose correct pair :
- AChlorophyll $-a \rightarrow$ Reaction centre
- BChlorophyll $-a \rightarrow$ green in colour
- CCarotenoids $\rightarrow$ Yellow to yellow -orange colour
- ✓All correct
✓
Answer
Correct option: D.
All correct
d
Need a full question paper?
Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.
Explore more
Similar questions
Short lived immunity acquired from mother to foetus across the placenta or through mother's milk to the infant is categorised as:
Which one of the following is not true about the light reactions of photosynthesis?
Identify the components labelled $A, B, C$ and $D$ in the diagram below from the list $(i)$ to $(viii)$ given along with
→Components:
$(i)$ Cristae of mitochondria
$(ii)$ Inner membrane of mitochondria
$(iii)$ Cytoplasm
$(iv)$ Smooth endoplasmic reticulum
$(v)$ Rough endoplasmic reticulum
$(vi)$ Mitochondrial matrix
$(vii)$ Cell vacuole
$(viii)$ NucleusThe correct components are:
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?
→The pollen grain represents
Keolado national park is situated at ______ and is famous for ______.
In an angiosperm, male plant is diploid and female plant is tetraploid then endosperm will be
Which one of the following pairs is not correctly matched
Aerobic respiration is more advantageous to a large organism than anaerobic respiration, because aerobic respiration
Small fish get stuck near the bottom of a shark and derives its nutrition from it. This kind of association is called as