Cinchona plant is also known as: - Vidyadip

MCQ

Cinchona plant is also known as:

A
Prickly bark
B
Turmeric bark
✓
Peruvian bark
D
Devil's dung bark

✓

Answer

Correct option: C.

Peruvian bark

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

More "M.C.Q (1 Marks)" from Reproduction in organisms→Reproduction in organisms — all question types→BIOLOGY STD 12 Science question papers→Gujarat Board STD 12 Science question papers→Gujarat Board question paper generator→

Similar questions

Sequence of which of the following is used to know the phylogeny?

In desert grasslands, which type of animals are relatively more abundant?

Identify insect pollinated plant

The primates nearest to humans in the evolutionary line is

Cryptorchidism is a condition where.

Which of the following statement is incorrect about Leydig cells

What effect would you expect if gene expression of the lac operon were completely repressed?

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?

$A$ : $ELISA$ can enable very easy detection of infection through antigen antibody interaction.

$R$ : It is a nucleic acid based diagonostic tool that can confirm presence of infectious microbe at early stages.

A man can inherit his $X-$chromosome from his