Correct definition of pollination is - Vidyadip

MCQ

Correct definition of pollination is

✓
Transfer of pollen grain from anther to stigma
B
Germination of pollen grain
C
Growth of pollen tube in ovule
D
Visits of insects in flower

✓

Answer

Correct option: A.

Transfer of pollen grain from anther to stigma

a
It’s obvious.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

More "M.C.Q (1 Marks)" from STD 12 - 1. sexual reproduction in flowering plants→STD 12 - 1. sexual reproduction in flowering plants — all question types→Biology STD 12 Science question papers→CBSE Board STD 12 Science question papers→CBSE Board question paper generator→

Similar questions

$A$ : Western ghats are included among the hot spots of biodiversity.

$R$ : Western ghats have greater amphibian diversity than eastern ghats.

__$A$__ enzyme is used to remove clots from the blood vessels of patients who have undergone __$B$__ leading to heart attack.

Given below are two statements :

Statement $I:$Cleistogamous flowers are invariably autogamous

Statement $II:$Cleistogamy is disadvantageous as there is no chance for cross pollination.

In the light of the above statements, choose the correct answer from the options given below :

In a dihybrid cross $\ce{AABB \times aabb,} \text{F2}$ progeny of $\text{AABB, AABb, AaBB}$ and $\text{AaBb}$ occurs in the ratio of.

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows $5'AUCGAUCGAUCGAUCGAUCGAUCG\,AUCG 3'$?

Typhoid fever could be confirmed by:

An ecosystem is a complex interacting system of

Which one of the following represents a palindromic sequence in $DNA$ ?

Exotic species.

In a cross between a male and female, both heterozygous for sickle cell anaemia gene, what percentage of the progeny will be diseased? (In $\%$)