MCQ
Identify protein.
  • A
    Insulin
  • B
    Chitin
  • C
    Lecithin
  • Trypsin

Answer

Correct option: D.
Trypsin
d

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Similar questions

In Riccia / Marchantia the rhizoids are
The alga rich in protein is
A scientist "$X$" demonstrated that extract of infected plants of " $Y$ " could cause infection in healthy plants and called the fluid as "Contagium vivum fluidum". Identify $X$ and $Y$.
Enzymes are the polymers of
The genome of transducing phages is
Spirogyra cells contain
Stem modified into green, flattened branches of unlimited growth for assimilatory function is
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

From which of the following algae, agar-agar is commercially extracted?

$I.$ Gracilaria $II.$ Fucus $III.$ Sargassum $IV.$ Gelidium $V.$ Turbinaria

Mark the given statements True (T) or False (F).
(i) Aristotle was the earliest scientist to attempt a more scientific basis for classification. He used complex morphological characters to classify plants into trees. shrubs and herbs.
(ii) Fungi have cellulose in their walls while green plants have chitin in cell wall.
(iii) According to five kingdom of classification, the unicellular prokaryotic organisms were placed in kingdom protista.
(iv) The classification system is not only based on morphological, physiological and reproductive similarities, but is also phylogenetic ie. is based on evolutionary relationships.
(v) Methanogens are present in the gut of several ruminant animals such as cows and buffaloes and they are responsible for the production of methane from the dung of these animals.
(vi) In Nostoc, site of oxygen fixation is heterocysts.
(vii) Cholera, tetanus, citrus canker are well known diseases caused by different bacteria.
(viii) Bacteria reproduce mainly by fission.
(ix) The mycoplasma are organisms that completely lack a cell wall. They are smallest living cells known and can survive without oxygen.
(x) Chrysophytes, Euglenoids and Slime moulds belong to kingdom protista.
Choose the correct option given below : -