Download App

STD 12 - 7. human health and disease — Biology STD 12 Science — Question

CBSE BoardEnglish MediumSTD 12 ScienceBiologySTD 12 - 7. human health and disease1 Mark
MCQ
Immunoglobulins are made up of
  • A
    Two polypeptide chains
  • ✓
    Four polypeptide chains
  • C
    Three amino acids only
  • D
    Five nucleotides
✓

Answer

Correct option: B.
Four polypeptide chains
b
Immunoglobulins are present in serum and provide immunity to body against diseases. Each immunoglobulin is made up of four polypeptide chains-two heavy weight chains and two light weight chains. These chains are joined to each other by disulphide bonds.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

More "M.C.Q (1 Marks)" from STD 12 - 7. human health and disease→STD 12 - 7. human health and disease — all question types→Biology STD 12 Science question papers→CBSE Board STD 12 Science question papers→CBSE Board question paper generator→

Similar questions

Which one of the following sets includes the bacterial disease
→
The cause of zero growth of population is
→
Which of the following statements is correct?
→
If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by assignment of function to different segments, the methodology adopted by him is called as :
→
Polar bodies are formed during
→
Father of Indian ecology is
→
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

→
IUDS within .......... of coitus have been found to be very effective as emergency contraceptives as they could be used to avoid possible pregnancy due to rape or casual unprotected intercourse.
→
If a pea plant is represented by $Rr$, what type of information is obtained
→
The net primary productivity of an ecosystem is
→