Download App

STD 11 - 6. Anatomy flowering plants — NEET STD 11 Science — Question

Gujarat BoardEnglish MediumSTD 11 ScienceNEETSTD 11 - 6. Anatomy flowering plants4 Marks
MCQ
In dicot root
  • A
    Vascular bundles are scattered and with cambium
  • B
    Vascular bundles are arranged in a ring and have cambium
  • ✓
    Xylem and phloem radially arranged
  • D
    Xylem is always endarch
✓

Answer

Correct option: C.
Xylem and phloem radially arranged
c
(c) The xylem and phloem strands alternate with each other separated by parenchymatous cells. Such kinds of vascular bundles are called radial and found mainly in roots.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

NEET STD 11 Science question papers→Gujarat Board STD 11 Science question papers→Gujarat Board question paper generator→

Similar questions

Xenogamy or cross-pollination is performed by

$I$. Abiotic agencies

$II$. Biotic agencies

$III$. Insects only

Select the correct option for the given question

→
Pinus seed is originated in
→
In a mixture, $DNA$ fragments are separated by
→
Which of the following statements is not correct?
→
Assertion: Leaf develops at the node and bears a bud in its axil.
Reason: Leaves of dicotyledonous plants generally possess parallel venation.
→
Which of the following species is restricted to a specific area?
→
In a food chain, the total amount of living material is depicted by
→
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

→
In which of the following, all listed genera belong to the same class of algae?
→
Which of the following figures correctly represents the replication fork formed during $DNA$ replication
→