Biotechnology: Principles and Processes — BIOLOGY STD 12 Science — Question

What is the difference between a primary oöcyte and a secondary oöcyte?

Study the figure given:

1. Pick out and name the cells that undergo spermiogenesis.
2. Name ‘a’ and ‘b’ cells. What is the difference between them with reference to the number of chromosomes?
3. Pick out and name the motile cells.
4. What is ‘f’ cell? Mention its function.
5. Name the structure of which the given diagram is a part.

Explain the increase in the numbers of melanic (dark winged) moths in the urban areas of post-industrialisation period in England.

(a) Which enzyme has recognition sequence shown in the diagram given below? (b) What is meant by palindrome?
(c) Enzyme in the given diagram cuts DNA to produce ———- ends.

If the duration of the atrial ‘systole is 0.1 second and that of complete diastole is 0.4 second, then how does one cardiac cycle complete in 0.8 second?

A dihybrid heterozygous round, yellow seeded garden pea was crossed with a double recessive plant.

1. What type of cross is this?
2. Work out the genotype and phenotype of the progeny.
3. What principle of Mendel is illustrated through the result of this cross?

(a) Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
(b) How many amino acids will be there in the polypeptide chain formed on the following mRNA ?
5' GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'

List the four important changes, taking place during biotic succession.

Explain the mechanism of reflex action with the help of a suitable diagram.