Okazaki fragments are synthesised on: - Vidyadip

MCQ

Okazaki fragments are synthesised on:

A
Leading strands of $\text{DNA}$ only
✓
Lagging strands of $\text{DNA}$ only
C
Both leading and lagging strands of $\text{DNA}$
D
Complementary $\text{DNA}$

✓

Answer

Correct option: B.

Lagging strands of $\text{DNA}$ only

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

More "M.C.Q (1 Marks)" from Molecular Basis of Inheritance→Molecular Basis of Inheritance — all question types→BIOLOGY STD 12 Science question papers→Gujarat Board STD 12 Science question papers→Gujarat Board question paper generator→

Similar questions

Reproduction is essential for living organisms in order to:

Two genes $'A\ ’$ and $'B\ ’$ are linked. In a dihybrid cross involving these two genes, the $\mathrm{F}_1$ heterozygote is crossed with homozygous recessive parental type $\text{(aa bb)}.$ What would be the ratio of offspring in the next generation?

Clot buster obtained from Streptococcus and modified by genetic engineering is:

Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

Eggs of which one of these can develop parthenogenetically by chemicals?

Pollination occurs when a pollen grain

Ringworm is spread through:

Eco R1 cuts the DNA between bases G and A only when the sequence of GAATTC is present. The number of nucleotides present in the resultant sticky ends that will be formed in each of the two strands of DNA after this enzyme cuts the DNA will be:

	Vector DNA	Foreign DNA
A	1 & 5	5 &1
B	2 & 4	4 &2
C	2 & 5	5 & 2
D	3 & 4	4 & 3

The chances of contracting bird flu from a properly cooked $($above $100^\circ C)$ chicken and egg are:

Wildlife conservation aims at

$I$. Maintaining the ecological process.

$II$. To enrich the wild life diversity with exotic species.

$III$. Preventing migration of species.

$IV$. Maintaining the diversity of life.

The correct statement are