Pisciculture does not include: - Vidyadip

MCQ

Pisciculture does not include:

A
Rohu
B
Prawns
✓
Silkworm
D
Crabs

✓

Answer

Correct option: C.

Silkworm

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

More "M.C.Q (1 Marks)" from Strategies for Enhancement in Food Reproduction→Strategies for Enhancement in Food Reproduction — all question types→BIOLOGY STD 12 Science question papers→Gujarat Board STD 12 Science question papers→Gujarat Board question paper generator→

Similar questions

Microbes are used in

$1.$ primary treatment of sewage

$2.$ secondary treatment of sewage

$3.$ anaerobic sludge digester

$4.$ production of bioactive molecules

The specific amount of living at each trophic level known as:

The active chemical drug reserpine is obtained from:

Rajaji national park is situated in:

Choose correct options

- Autogamy is genetically xenogamy

- Pollination occurs by air in grass

- Placenta is arranged in inner wall of ovary

- It is possible to store pollen grains in liquid nitrogen - $100^oC$

Stage transferred to uterus after induced fertilization of ova in the laboratory is:

According to the chromosomal theory of inheritance, the genes are located on the chromosomes $.............$ manner.

Sickle cell anemia is caused by:

Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

Golden rice is a transgenic crop of the future with the following improved trait