Download App

Organisms and Populations — BIOLOGY STD 12 Science — Question

Maharashtra BoardEnglish MediumSTD 12 ScienceBIOLOGYOrganisms and Populations3 Marks
Question
Study the population growth curve given below and answer the questions that follow:
  1. Identify ‘A’ and ‘B’ shown in the graph.
  2. When and why do such curves occur in a population?
✓

Answer

  1. ‘A’ - Exponential.
‘B’ - Logistic.
  1. ‘A’- Exponential growth - when resources (food and space) are not limiting/ when resources in the habitat are unlimited, each species has the ability to realise its full potential to grow in number in absence of checks.
‘B’ - Logistic growth - When resources become limiting/ competition between individuals for limited resources occurs, the fittest individuals will survive and reproduce.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

More "Answer the following questions in detail." from Organisms and Populations→Organisms and Populations — all question types→BIOLOGY STD 12 Science question papers→Maharashtra Board STD 12 Science question papers→Maharashtra Board question paper generator→

Similar questions

Identify 'a', 'b', 'c', 'd', 'e' and 'f' in the table given below:
No. Syndrome Cause Characteristics of affected individual Sex Male/Female/Both
1 Down’s Trisomy of 21
‘a’ (i)
(ii)
 'b'
2 ‘c’ XXY Overall masculine development ‘d’
3 Turner’s 45 with OX
‘e’ (i)
(ii)
 ‘f’
→
Write a short note on Behavioural adaptations in animals
→
What are the advantages of using biofertilisers in agriculture?
→
State Hardy-Weinberg Principle and give the algebraic equation for the distribution of genotypes.
→
What is parturition? Which hormones are involved in induction of parturition?
→
Explain with the help of suitable examples the three different ways by which organisms overcome their stressful conditions lasting for short duration.
→
(a) Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
(b) How many amino acids will be there in the polypeptide chain formed on the following mRNA ?
5' GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3'
→
Describe the three different types of IUDs available at present, with an example for each.
→
Throughout sexual reproduction the chromosome number is maintained same. How is this done?
→
Explain any three causes of substance abuse during adolescence.
→