Download App

STD 11 - 9. Biomolecules — NEET STD 11 Science — Question

Gujarat BoardEnglish MediumSTD 11 ScienceNEETSTD 11 - 9. Biomolecules4 Marks
MCQ
Sugar and amino acids are
  • ✓
    Primary metabolites
  • B
    Secondary metabolites
  • C
    Feed stock
  • D
    Inoculum
✓

Answer

Correct option: A.
Primary metabolites
a
It's Obvious

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

NEET STD 11 Science question papers→Gujarat Board STD 11 Science question papers→Gujarat Board question paper generator→

Similar questions

Select the correct pair.
→
Bacillus thuringiensis is a bacterium of
→
Which of the following produces spores, but lacks vascular structure
→
The region or part of root that increases the surface area for water absorption is
→
Find the correct palindromic sequence:

$5 'ATTGCAAT3'$

→
The amino acids in a protein are held together by
→
Which of the following is absent in root hair
→
$DNA$-­dependent $RNA$ polymerase catalyses transcription on one strand of the $DNA$ which is called the
→
Break down process is also called
→
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

→