Download App

Molecular Basis of Inheritance — BIOLOGY STD 12 Science — Question

Gujarat BoardEnglish MediumSTD 12 ScienceBIOLOGYMolecular Basis of Inheritance1 Mark
MCQ
What are the $\text{DNA}$ sequences that code for protein known as?
  • A
    Introns
  • ✓
    Exons
  • C
    Control regions
  • D
    Intervening sequences
✓

Answer

Correct option: B.
Exons
$\text{DNA}$ initially transcribed to messenger $\text{RNA},$ consists of coding sequences which are called as exons which codes for proteins and non$-$coding sequences which are called as introns.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

More "M.C.Q (1 Marks)" from Molecular Basis of Inheritance→Molecular Basis of Inheritance — all question types→BIOLOGY STD 12 Science question papers→Gujarat Board STD 12 Science question papers→Gujarat Board question paper generator→

Similar questions

Which one is a true statement regarding $DNA$ polymerase used in polymerase chain reaction?
→
The total energy fixed by a gram plant (Cicer arietinum) in an ecosystem on the whole is called
→
Which one of the following is a pair of viral disease
→
Two enzymes responsible for restricting the growth of bacteriophages in $E .$ coli were isolated. One was methylase and other was restriction endonuclease. What is the significance of methylase?
→
The term 'The Evil Quartet' is related with the major causes of
→
In case of incomplete dominance in $F_2$ generation
→
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

→
Population termed $r$ - strategists
→
This creature was called the first human - likebeing the hominid, their brain capacities
→
Operon model for regulation of transcription was proposed by.
→