Download App

STD 12 - 1. sexual reproduction in flowering plants — BIOLOGY STD 12 Science — Question

Gujarat BoardEnglish MediumSTD 12 ScienceBIOLOGYSTD 12 - 1. sexual reproduction in flowering plants1 Mark
MCQ
Which of the following is incorrect in angiosperm?
  • A
    Pollen grain - Haploid
  • ✓
    Megaspore - Diploid
  • C
    Synergid - Haploid
  • D
    Endosperm - Triploid
✓

Answer

Correct option: B.
Megaspore - Diploid
b
In angiosperm, a single diploid Megaspore Mother Cell (MMC) matures within an ovule. Through first meiosis, it gives rise to a dyad cell and then second meiosis takes place which forms four megaspores (haploid). In most plants, only one of these megaspore, survives, the rest are absorbed by the ovule.

Need a full question paper?

Generate a complete, print-ready paper with questions like this in minutes — across 16+ boards, with answer keys.

Start Generating Free

Explore more

More "M.C.Q (1 Marks)" from STD 12 - 1. sexual reproduction in flowering plants→STD 12 - 1. sexual reproduction in flowering plants — all question types→BIOLOGY STD 12 Science question papers→Gujarat Board STD 12 Science question papers→Gujarat Board question paper generator→

Similar questions

Assertion : Copper $-T$ is an effective contraceptive device in human females.

Reason : Copper $-T$ prevents passage of sperms from vagina upwards into fallopian tubes.

→
Sex is determined in human beings:
→
If a double stranded DNA has 35 percent Guanine, Calculate the percent of thymine in the DNA.
→
Restriction endonucleases are enzymes that cleave DNA molecules into smaller fragments. Which type of bond do they act on?
→
Biotic factors are
→
In Drosophila the XXY constitution determines:
→
Which one is the correct product of $DNA$ dependent $RNA$ polymerase to the given template?

$3$'$TACATGGCAAATATCCATTCA5'$

→
In human female the blastocyst
→
An important evidence in favour of organic evolution is the occurrence of:
→
$MALT$ constitutes about _______ percent of the lymphoid tissue in human body.
→